| Basic information from miRBase |
| hairpin accession number: MI0008415 |
| Located between position 10660844 and 10660923 on chromosome 19 strand - |
| Overlapping with sense strand of (5UTR 1). |
| (Ensemble: ENSPTRT00000019275) |
| mature miRNAs for MI0008415: |
| ptr-miR-1181 (MIMAT0007949): CCGTCGCCGCCACCCGAGCCG |
| You can find this miRNA in ENTREZGENE: MIR1181 (accession: 100316042) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |