Basic information from miRBase |
hairpin accession number: MI0008741 |
Located between position 49929150 and 49929239 on chromosome X strand + |
mature miRNAs for MI0008741: |
ptr-miR-532 (MIMAT0008213): CCTCCCACACCCAAGGCTTGCA |
You can find this miRNA in ENTREZGENE: MIR532 (accession: 100316207) |
References |
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |