miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0008741
Located between position 49929150 and 49929239 on chromosome X strand +
mature miRNAs for MI0008741:
         ptr-miR-532 (MIMAT0008213): CCTCCCACACCCAAGGCTTGCA
You can find this miRNA in ENTREZGENE: MIR532 (accession: 100316207)

References
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome"