| Basic information from miRBase |
| hairpin accession number: MI0008617 |
| Located between position 73712533 and 73712626 on chromosome 11 strand - |
| Overlapping with sense strand of (intron 1). |
| (Ensemble: ENSPTRT00000042649) |
| mature miRNAs for MI0008617: |
| ptr-miR-326 (MIMAT0008099): CCTCTGGGCCCTTCCTCCAG |
| You can find this miRNA in ENTREZGENE: MIR326 (accession: 100316140) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |