| Basic information from miRBase |
| hairpin accession number: MI0008438 |
| Located between position 32522317 and 32522417 on chromosome 6 strand - |
| Overlapping with sense strand of (intron 3). |
| (Ensemble: ENSPTRT00000057467) |
| mature miRNAs for MI0008438: |
| ptr-miR-1236 (MIMAT0007968): CCTCTTCCCCTTGTCTCTCCA |
| You can find this miRNA in ENTREZGENE: MIR1236 (accession: 100316053) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |