| Basic information from miRBase |
| hairpin accession number: MI0008418 |
| Located between position 154681023 and 154681120 on chromosome X strand - |
| Overlapping with antisense strand of XM_001147859.1 (3UTR 1). |
| (Ensemble: ENSPTRT00000054835) |
| mature miRNAs for MI0008418: |
| ptr-miR-1184 (MIMAT0007952): CCTGCAGCGACTTGATGGCTTCC |
| You can find this miRNA in ENTREZGENE: MIR1184 (accession: 100316309) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |