miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0002181
Located between position 2103466 and 2103542 on chromosome 2 strand -
Overlapping with sense strand of pth1ra-001 (intron 6).
(Ensemble: OTTDART00000023732)
mature miRNAs for MI0002181:
         dre-miR-460-5p (MIMAT0001887): CCTGCATTGTACACACTGTGCG
         dre-miR-460-3p (MIMAT0001888): CACAGCGCATACAATGTGGATG
You can find this miRNA in ENTREZGENE: mir460 (accession: 100033530)

References
[1]Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T, Genes Dev. 19:1288-1293(2005)., "The developmental miRNA profiles of zebrafish as determined by small RNA cloning"