| Basic information from miRBase |
| hairpin accession number: MI0015553 |
| Located between position 5615210 and 5615267 on chromosome 5q strand + |
| mature miRNAs for MI0015553: |
| cin-miR-4011a-5p (MIMAT0016508): CACAGTGGAGGTAAAGATTG |
| cin-miR-4011a-3p (MIMAT0016509): CGATTTTTGCTTTCCACTGC |
| You can find this miRNA in ENTREZGENE: mir4011a (accession: 100498898) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |