miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0012780
Located between position 50242526 and 50242608 on chromosome 11 strand -
Overlapping with antisense strand of ACADVL (intron 12).
(Ensemble: ENSECAT00000026882)
mature miRNAs for MI0012780:
         eca-miR-324-5p (MIMAT0013033): CGCATCCCCTAGGGCATTGGTGT
         eca-miR-324-3p (MIMAT0013034): CCACTGCCCCAGGTGCTGCTGG
You can find this miRNA in ENTREZGENE: MIR324 (accession: 100314846)

References
[1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach"