Basic information from miRBase |
hairpin accession number: MI0015604 |
Located between position 627148 and 627209 on chromosome scaffold_55 strand - |
mature miRNAs for MI0015604: |
cin-miR-4053-5p (MIMAT0016595): CGCCGGGGTATGACGTCGT |
cin-miR-4053-3p (MIMAT0016596): TAGTACGTCGTTCTCCGGACGG |
You can find this miRNA in ENTREZGENE: mir4053 (accession: 100498925) |
References |
[1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |