| Basic information from miRBase |
| hairpin accession number: MI0015607 |
| Located between position 863632 and 863684 on chromosome 5q strand - |
| mature miRNAs for MI0015607: |
| cin-miR-4056-5p (MIMAT0016601): ACTGATGTAGAACAAGGCATGCG |
| cin-miR-4056-3p (MIMAT0016602): CGCGTCTTGTTCTACTCACC |
| You can find this miRNA in ENTREZGENE: mir4056 (accession: 100499064) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |