miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0008460
Located between position 147366312 and 147366377 on chromosome 1 strand +
Overlapping with sense strand of XM_001174778.1 (intron 7).
(Ensemble: ENSPTRT00000065051)
mature miRNAs for MI0008460:
         ptr-miR-1255b (MIMAT0007980): CGGATGAGCAAAGAAAGTGGTT
You can find this miRNA in ENTREZGENE: MIR1255B (accession: 100316518)

References
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome"