| Basic information from miRBase |
| hairpin accession number: MI0009927 |
| Located between position 40949299 and 40949398 on chromosome 12 strand - |
| Overlapping with antisense strand of WU:RP23-111F7.1-001 (3UTR 1). |
| (Ensemble: OTTMUST00000090790) |
| mature miRNAs for MI0009927: |
| mmu-miR-1938 (MIMAT0009402): CGGTGGGACTTGTAGTTCGGTC |
| You can find this miRNA in MGI: Mir1938 (accession: 3836976) |
| References |
| [1]Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK, Genome Res. 18:1787-1797(2008)., "In-depth characterization of the microRNA transcriptome in a leukemia progression model" |