| Basic information from miRBase |
| hairpin accession number: MI0007789 |
| Located between position 59821546 and 59821632 on chromosome 19 strand + |
| mature miRNAs for MI0007789: |
| mml-miR-518a-5p (MIMAT0006377): CTACAAAGGGAAGCCCTTTC |
| mml-miR-518a-3p (MIMAT0006378): GAAAGTGCTTCTCTTTGCTGG |
| You can find this miRNA in ENTREZGENE: MIR518A (accession: 100315413) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |