miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0008551
Located between position 140547224 and 140547312 on chromosome 8 strand -
Overlapping with sense strand of (intron 19).
(Ensemble: ENSPTRT00000067822)
mature miRNAs for MI0008551:
         ptr-miR-151 (MIMAT0008045): CTAGACTGAAGCTCCTTGAGG
You can find this miRNA in ENTREZGENE: MIR151 (accession: 100316106)

References
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome"