Basic information from miRBase |
hairpin accession number: MI0008551 |
Located between position 140547224 and 140547312 on chromosome 8 strand - |
Overlapping with sense strand of (intron 19). |
(Ensemble: ENSPTRT00000067822) |
mature miRNAs for MI0008551: |
ptr-miR-151 (MIMAT0008045): CTAGACTGAAGCTCCTTGAGG |
You can find this miRNA in ENTREZGENE: MIR151 (accession: 100316106) |
References |
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |