| Basic information from miRBase |
| hairpin accession number: MI0015743 |
| Located between position 4071088 and 4071157 on chromosome 8q strand - |
| Overlapping with sense strand of (intron 13). |
| (Ensemble: ENSCINT00000024604) |
| mature miRNAs for MI0015743: |
| cin-miR-4186-5p (MIMAT0016804): CTAGATGAGGCAAGAGTGAG |
| You can find this miRNA in ENTREZGENE: mir4186 (accession: 100499136) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |