| PROMOTER INFORMATION | ||||||||||||||
| 22 | chr14, 100410250-100410583, + | promoter sequence | Zhou et al. |  | | |||||||||
| 979 | chr14, 100405583-100410675, + | promoter sequence | UCSC | | | |||||||||
This microRNA is imprinted (based on ncRNAimprinted database) |
| more data |
| Expression data from PhenomiR |
| Basic information from miRBase |
| hairpin accession number: MI0000806 |
| Located between position 101340830 and 101340922 on chromosome 14 strand + |
| mature miRNAs for MI0000806: |
| hsa-miR-337-5p (MIMAT0004695): GAACGGCTTCATACAGGAGTT |
| hsa-miR-337-3p (MIMAT0000754): CTCCTATATGATGCCTTTCTTC |
| You can find this miRNA in TARGETS:PICTAR-VERT: hsa-miR-337 (accession: hsa-miR-337) |
| References | ||||||||||||||
| [1]Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G, Proc Natl Acad Sci U S A. 101:360-365(2004)., "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" | ||||||||||||||
| [2]Weber MJ, FEBS J. 272:59-73(2005)., "New human and mouse microRNA genes found by homology search" | ||||||||||||||
| [3]Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing" | ||||||||||||||
| PROMOTER INFORMATION | ||||||||||||||
| 22 | chr14, 100410250-100410583, + | promoter sequence | Zhou et al. | | | |||||||||
| 979 | chr14, 100405583-100410675, + | promoter sequence | UCSC | | | |||||||||
This microRNA is imprinted (based on ncRNAimprinted database) |
| more data |
| Expression data from PhenomiR |