Basic information from miRBase |
hairpin accession number: MI0008624 |
Located between position 101299411 and 101299502 on chromosome 14 strand + |
mature miRNAs for MI0008624: |
ptr-miR-337 (MIMAT0008105): CTCCTATATGATGCCTTTCTTC |
You can find this miRNA in ENTREZGENE: MIR337 (accession: 100316144) |
References |
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |