miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0003522
Located between position 50402580 and 50402664 on chromosome X strand -
mature miRNAs for MI0003522:
         mmu-miR-542-5p (MIMAT0003171): CTCGGGGATCATCATGTCACGA
         mmu-miR-542-3p (MIMAT0003172): TGTGACAGATTGATAACTGAAA
You can find this miRNA in MGI: Mir542 (accession: 3619431)

References
[1]Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M, BMC Bioinformatics. 6:267(2005)., "Identification of clustered microRNAs using an ab initio prediction method"
[2]Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I, Nucleic Acids Res. 34:1765-1771(2006)., "The expression profile of microRNAs in mouse embryos"
[3]Takada S, Berezikov E, Yamashita Y, Lagos-Quintana M, Kloosterman WP, Enomoto M, Hatanaka H, Fujiwara S, Watanabe H, Soda M, Choi YL, Plasterk RH, Cuppen E, Mano H, Nucleic Acids Res. 34:e115(2006)., "Mouse microRNA profiles determined with a new and sensitive cloning method"
[4]Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing"
[5]Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A, Mol Hum Reprod. 16:463-471(2010)., "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
[6]Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP, Genes Dev. 24:992-1009(2010)., "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"


more data
Expression data from PhenomiR