| Basic information from miRBase |
| hairpin accession number: MI0008322 |
| Located between position 21537029 and 21537109 on chromosome 13 strand + |
| Overlapping with antisense strand of Zfp187-001 (exon 6). |
| (Ensemble: OTTMUST00000000990) |
| mature miRNAs for MI0008322: |
| mmu-miR-1896 (MIMAT0007873): CTCTCTGATGGTGGGTGAGGAG |
| You can find this miRNA in MGI: Mir1896 (accession: 3811418) |
| References |
| [1]He S, Su H, Liu C, Skogerbo G, He H, He D, Zhu X, Liu T, Zhao Y, Chen R, BMC Genomics. 9:236(2008)., "MicroRNA-encoding long non-coding RNAs" |