| Basic information from miRBase |
| hairpin accession number: MI0013152 |
| Located between position 55165137 and 55165216 on chromosome X strand - |
| Overlapping with sense strand of (exon 1). |
| (Ensemble: ENSSSCT00000021415) |
| mature miRNAs for MI0013152: |
| ssc-miR-676-5p (MIMAT0017382): CTCTTCAATCTCAGGACTCGCA |
| ssc-miR-676-3p (MIMAT0013943): CCGTCCTAAGGTTGTTGAGTT |
| You can find this miRNA in ENTREZGENE: MIR676 (accession: 100498740) |
| References |
| [1]Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B, Anim Genet. 41:159-168(2010)., "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" |
| [2]Sharbati S, Friedlander MR, Sharbati J, Hoeke L, Chen W, Keller A, Stahler PF, Rajewsky N, Einspanier R, BMC Genomics. 11:275(2010)., "Deciphering the porcine intestinal microRNA transcriptome" |