Basic information from miRBase |
hairpin accession number: MI0008739 |
Located between position 59373922 and 59374003 on chromosome 19 strand + |
mature miRNAs for MI0008739: |
ptr-miR-526b (MIMAT0008211): CTCTTGAGGGAAGCACTTTCTGT |
You can find this miRNA in ENTREZGENE: MIR526B (accession: 100316206) |
References |
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |