miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0008739
Located between position 59373922 and 59374003 on chromosome 19 strand +
mature miRNAs for MI0008739:
         ptr-miR-526b (MIMAT0008211): CTCTTGAGGGAAGCACTTTCTGT
You can find this miRNA in ENTREZGENE: MIR526B (accession: 100316206)

References
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome"