miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0006794
Located between position 1 and 91 on chromosome Contig35411 strand -
mature miRNAs for MI0006794:
         oan-miR-192 (MIMAT0007016): CTGACCTATGAATTGACAGCC
         oan-miR-192* (MIMAT0007017): CTGCCAATTCCATAGGTCACAG
You can find this miRNA in ENTREZGENE: MIR192 (accession: 100314662)

References
[1]Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ, Genome Res. 18:995-1004(2008)., "Conservation of small RNA pathways in platypus"