| Basic information from miRBase |
| hairpin accession number: MI0008565 |
| Located between position 63311885 and 63311993 on chromosome 11 strand - |
| mature miRNAs for MI0008565: |
| ptr-miR-192 (MIMAT0008057): CTGACCTATGAATTGACAGCC |
| You can find this miRNA in ENTREZGENE: MIR192 (accession: 100316449) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |