| Basic information from miRBase |
| hairpin accession number: MI0000935 |
| Located between position 209040256 and 209040365 on chromosome 1 strand + |
| mature miRNAs for MI0000935: |
| rno-miR-192 (MIMAT0000867): CTGACCTATGAATTGACAGCC |
| rno-miR-192* (MIMAT0017147): CTGCCAGTTCCATAGGTCACAG |
| You can find this miRNA in ENTREZGENE: Mir192 (accession: 100314193) |
| References |
| [1]Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H, Genes Dev. 20:1732-1743(2006)., "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" |
| [2]Linsen SE, de Wit E, de Bruijn E, Cuppen E, BMC Genomics. 11:249(2010)., "Small RNA expression and strain specificity in the rat" |