| Basic information from miRBase |
| hairpin accession number: MI0008889 |
| Located between position 2062174 and 2062270 on chromosome 4 strand - |
| Overlapping with sense strand of XM_517069.2 (exon 5). |
| (Ensemble: ENSPTRT00000029571) |
| mature miRNAs for MI0008889: |
| ptr-miR-943 (MIMAT0008349): CTGACTGTTGCCGTCCTCCAG |
| You can find this miRNA in ENTREZGENE: MIR943 (accession: 100316287) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |