| Basic information from miRBase |
| hairpin accession number: MI0008740 |
| Located between position 59434374 and 59434459 on chromosome 19 strand + |
| mature miRNAs for MI0008740: |
| ptr-miR-527 (MIMAT0008212): CTGCAAAGGGAAGCCCTTTC |
| You can find this miRNA in ENTREZGENE: MIR527 (accession: 100316482) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |