Basic information from miRBase |
hairpin accession number: MI0015777 |
Located between position 2082406 and 2082478 on chromosome 4q strand + |
Overlapping with sense strand of (intron 37). |
(Ensemble: ENSCINT00000011356) |
mature miRNAs for MI0015777: |
cin-let-7f-5p (MIMAT0016842): TGAGGTAGTGGATTCTGT |
cin-let-7f-3p (MIMAT0016843): CTGCACATTCCACCATCTCGT |
You can find this miRNA in ENTREZGENE: mirlet7f (accession: 100499144) |
References |
[1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" ![]() |