| Basic information from miRBase |
| hairpin accession number: MI0016079 |
| Located between position 73402150 and 73402243 on chromosome 17 strand + |
| mature miRNAs for MI0016079: |
| hsa-miR-3678-5p (MIMAT0018102): TCCGTACAAACTCTGCTGTG |
| hsa-miR-3678-3p (MIMAT0018103): CTGCAGAGTTTGTACGGACCGG |
| You can find this miRNA in ENTREZGENE: MIR3678 (accession: 100500841) |
| References |
| [1]Vaz C, Ahmad HM, Sharma P, Gupta R, Kumar L, Kulshreshtha R, Bhattacharya A, BMC Genomics. 11:288(2010)., "Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood" |