| PROMOTER INFORMATION | ||||||||||||||
| 364 | chr5, 137099577-137099777, - | promoter sequence | Marson et al. |  | | |||||||||
| 669 | chr5, 137011160-137016237, - | promoter sequence | UCSC | | | |||||||||
| more data |
| Expression data from PhenomiR |
| Basic information from miRBase |
| hairpin accession number: MI0005532 |
| Located between position 136983261 and 136983338 on chromosome 5 strand - |
| Overlapping with sense strand of KLHL3-002 (intron 7). |
| (Ensemble: OTTHUMT00000372234) |
| mature miRNAs for MI0005532: |
| hsa-miR-874 (MIMAT0004911): CTGCCCTGGCCCGAGGGACCGA |
| You can find this miRNA in HGNC: MIR874 (accession: 33643) |
| References | ||||||||||||||
| [1]Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing" | ||||||||||||||
| [2]Lui WO, Pourmand N, Patterson BK, Fire A, Cancer Res. 67:6031-6043(2007)., "Patterns of known and novel small RNAs in human cervical cancer" | ||||||||||||||
| PROMOTER INFORMATION | ||||||||||||||
| 364 | chr5, 137099577-137099777, - | promoter sequence | Marson et al. | | | |||||||||
| 669 | chr5, 137011160-137016237, - | promoter sequence | UCSC | | | |||||||||
| more data |
| Expression data from PhenomiR |