miRNEST 2.0, an integrative microRNA resource

miRNEST 2.0, an integrative microRNA resource :: Browse

Basic information from miRBase

hairpin accession number: MI0005479

Located between position 58124486 and 58124561 on chromosome 13 strand -

Overlapping with sense strand of WU:Klhl3-001 (intron 8).

(Ensemble: OTTMUST00000087800)

mature miRNAs for MI0005479:

mmu-miR-874* (MIMAT0017268): CGGCCCCACGCACCAGGGTAAG

mmu-miR-874 (MIMAT0004853): CTGCCCTGGCCCGAGGGACCGA

You can find this miRNA in MGI: Mir874 (accession: 3718564)

References

[1]Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing"

[2]Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A, Mol Hum Reprod. 16:463-471(2010)., "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"

[3]Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP, Genes Dev. 24:992-1009(2010)., "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"