| Basic information from miRBase |
| hairpin accession number: MI0011455 |
| Located between position 16178668 and 16178727 on chromosome 3 strand + |
| Overlapping with sense strand of SCARNA15 (exon 1). |
| (Ensemble: ENSBTAT00000062642) RFAM: RFAM) |
| mature miRNAs for MI0011455: |
| bta-miR-1940 (MIMAT0011971): CTGGAGGACTAAGAAGGCTGAGTCT |
| You can find this miRNA in ENTREZGENE: MIR1940 (accession: 100313293) |
| References |
| [1]Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ, PLoS One. 4:e6349(2009)., "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" |