Basic information from miRBase |
hairpin accession number: MI0000804 |
Located between position 67236224 and 67236298 on chromosome 16 strand - |
Overlapping with antisense strand of ELMO3-003 (intron 13). |
(Ensemble: OTTHUMT00000257669) |
mature miRNAs for MI0000804: |
hsa-miR-328 (MIMAT0000752): CTGGCCCTCTCTGCCCTTCCGT |
You can find this miRNA in TARGETS:PICTAR-VERT: hsa-miR-328 (accession: hsa-miR-328) |
References | ||||||||||||||
[1]Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G, Proc Natl Acad Sci U S A. 101:360-365(2004)., "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" | ||||||||||||||
[2]Weber MJ, FEBS J. 272:59-73(2005)., "New human and mouse microRNA genes found by homology search" | ||||||||||||||
[3]Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing" |
PROMOTER INFORMATION | ||||||||||||||
224 | chr16, 65817377-65819769, - | promoter sequence | Marson et al. | |||||||||||
478 | chr16, 65888841-65889091, - | promoter sequence | Fujita et al. | |||||||||||
1065 | chr16, 65793725-65798799, - | promoter sequence | UCSC |
more data |
Expression data from dbDEMC |
Expression data from PhenomiR |