| Basic information from miRBase |
| hairpin accession number: MI0008618 |
| Located between position 66941820 and 66941893 on chromosome 16 strand - |
| Overlapping with antisense strand of XM_001162242.1 (intron 12). |
| (Ensemble: ENSPTRT00000043976) |
| mature miRNAs for MI0008618: |
| ptr-miR-328 (MIMAT0008100): CTGGCCCTCTCTGCCCTTCCGT |
| You can find this miRNA in ENTREZGENE: MIR328 (accession: 100316380) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |