| Basic information from miRBase |
| hairpin accession number: MI0013164 |
| Located between position 188101720 and 188101799 on chromosome 1 strand - |
| mature miRNAs for MI0013164: |
| ssc-miR-1285 (MIMAT0013954): CTGGGCAACATAGCGAGACCCCGT |
| You can find this miRNA in ENTREZGENE: MIR1285 (accession: 100498748) |
| References |
| [1]Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B, Anim Genet. 41:159-168(2010)., "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" |