| more data |
| Data from CoGemiR |
| Basic information from miRBase |
| hairpin accession number: MI0005880 |
| Located between position 9361588 and 9361656 on chromosome I strand + |
| mature miRNAs for MI0005880: |
| cel-miR-1019* (MIMAT0005822): GTGAGCATTGTTCGAGTTTCATTTT |
| cel-miR-1019 (MIMAT0005032): CTGTAATTCCACATTGCTTTCCAG |
| References |
| [1]Ruby JG, Jan CH, Bartel DP, Nature. 448:83-86(2007)., "Intronic microRNA precursors that bypass Drosha processing" |
| [2]Zhang L, Ding L, Cheung TH, Dong MQ, Chen J, Sewell AK, Liu X, Yates JR 3rd, Han M, Mol Cell. 28:598-613(2007)., "Systematic identification of C. elegans miRISC proteins, miRNAs, and mRNA targets by their interactions with GW182 proteins AIN-1 and AIN-2" |
| more data |
| Data from CoGemiR |