| Basic information from miRBase |
| hairpin accession number: MI0008896 |
| Located between position 6881406 and 6881483 on chromosome LG6 strand + |
| mature miRNAs for MI0008896: |
| tca-let-7-5p (MIMAT0008354): TGAGGTAGTAGGTTGTATAG |
| tca-let-7-3p (MIMAT0019098): CTGTACAGCCTGCTAACTTTCCC |
| You can find this miRNA in ENTREZGENE: Mirlet7 (accession: 100314377) |
| References |
| [1]Singh J, Nagaraju J, Insect Mol Biol. 17:427-436(2008)., "In silico prediction and characterization of microRNAs from red flour beetle (Tribolium castaneum)" |
| [2]Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S, Genome Biol Evol. 2:686-696(2010)., "Functional shifts in insect microRNA evolution" |