| Basic information from miRBase |
| hairpin accession number: MI0008580 |
| Located between position 604255 and 604363 on chromosome 11 strand - |
| mature miRNAs for MI0008580: |
| ptr-miR-210 (MIMAT0008070): CTGTGCGTGTGACAGCGGCTGA |
| You can find this miRNA in ENTREZGENE: MIR210 (accession: 100316324) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |