| Basic information from miRBase |
| hairpin accession number: MI0015851 |
| Located between position 10341089 and 10341161 on chromosome 19 strand + |
| Overlapping with antisense strand of S1PR2-201 (intron 1). |
| (Ensemble: ENST00000317726) |
| mature miRNAs for MI0015851: |
| hsa-miR-4322 (MIMAT0016873): CTGTGGGCTCAGCGCGTGGGG |
| You can find this miRNA in ENTREZGENE: MIR4322 (accession: 100422925) |
| References |
| [1]Goff LA, Davila J, Swerdel MR, Moore JC, Cohen RI, Wu H, Sun YE, Hart RP, PLoS One. 4:e7192(2009)., "Ago2 immunoprecipitation identifies predicted microRNAs in human embryonic stem cells and neural precursors" |