miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0005811
Located between position 22511296 and 22511391 on chromosome 3L strand -
mature miRNAs for MI0005811:
         dme-miR-957-5p (MIMAT0020851): CTTAGTTTTCGACGTGTTTTGGT
         dme-miR-957-3p (MIMAT0005470): TGAAACCGTCCAAAACTGAGGC

References
[1]Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC, Genome Res. 17:1850-1864(2007)., "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"
[2]Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M, Genome Res. 17:1865-1879(2007)., "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes"


more data
Data from CoGemiR