| Basic information from miRBase |
| hairpin accession number: MI0012867 |
| Located between position 39789354 and 39789437 on chromosome 23 strand + |
| Overlapping with sense strand of LOC100064410 (intron 1). |
| (Ensemble: ENSECAT00000005193) |
| mature miRNAs for MI0012867: |
| eca-miR-491-5p (MIMAT0013116): AGTGGGGAACCCTTCCATGAGG |
| eca-miR-491-3p (MIMAT0013117): CTTATGCAAGATTCCCTTCTAC |
| You can find this miRNA in ENTREZGENE: MIR491 (accession: 100315107) |
| References |
| [1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" |