miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0016080
Located between position 134884696 and 134884763 on chromosome 2 strand +
Overlapping with sense strand of MGAT5-001 (intron 1).
(Ensemble: OTTHUMT00000254584)
mature miRNAs for MI0016080:
         hsa-miR-3679-5p (MIMAT0018104): TGAGGATATGGCAGGGAAGGGGA
         hsa-miR-3679-3p (MIMAT0018105): CTTCCCCCCAGTAATCTTCATC
You can find this miRNA in ENTREZGENE: MIR3679 (accession: 100500878)

References
[1]Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH, PLoS One. 5:e9637(2010)., "Discovery of novel microRNAs in female reproductive tract using next generation sequencing"
[2]Vaz C, Ahmad HM, Sharma P, Gupta R, Kumar L, Kulshreshtha R, Bhattacharya A, BMC Genomics. 11:288(2010)., "Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood"
[3]Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C, Cancer Res. 71:78-86(2011)., "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"