miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0006550
Located between position 9137255 and 9137447 on chromosome 6 strand +
mature miRNAs for MI0006550:
         vvi-miR319f (MIMAT0005705): TTGGACTGAAGGGAGCTCCCT
You can find this miRNA in ENTREZGENE: MIR319F (accession: 100272019)

References
[1]Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro, Nature. 449:463-467(2007)., "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla"
[2]Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS, BMC Genomics. 10:558(2009)., "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera"