| Basic information from miRBase |
| hairpin accession number: MI0001812 |
| Located between position 1455 and 1671 on chromosome AZM5_88281 strand - |
| mature miRNAs for MI0001812: |
| zma-miR159d* (MIMAT0015179): GAGCTCCCTTCGATCCAATCC |
| zma-miR159d (MIMAT0001714): CTTGGATTGAAGGGAGCTCCT |
| References |
| [1]Dezulian T, Palatnik JF, Huson DH, Weigel D, http://genomebiology.com/2005/6/11/p13 (2005)., "Conservation and divergence of microRNA families in plants" |
| [2]Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D, PLoS Genet. 5:e1000716(2009)., "A genome-wide characterization of microRNA genes in maize" |