| Basic information from miRBase |
| hairpin accession number: MI0013515 |
| Located between position 2323832 and 2323922 on chromosome CH477213.1 strand + |
| mature miRNAs for MI0013515: |
| aae-miR-263b (MIMAT0014309): CTTGGCACTGGGAGAATTCACAG |
| aae-miR-263b* (MIMAT0014310): TGGATCTTTTCGTGCCATCGT |
| References |
| [1]Li S, Mead EA, Liang S, Tu Z, BMC Genomics. 10:581(2009)., "Direct sequencing and expression analysis of a large number of miRNAs in Aedes aegypti and a multi-species survey of novel mosquito miRNAs" |