miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0008314
Located between position 34537386 and 34537464 on chromosome 3 strand +
Overlapping with sense strand of AC137708.1-203 (exon 1).
(Ensemble: ENSMUST00000168995)
mature miRNAs for MI0008314:
         mmu-miR-1897-5p (MIMAT0007864): CTTTGGATGGAGAAAGAGGGGG
         mmu-miR-1897-3p (MIMAT0007865): TCAACTCGTTCTGTCCGGTGAG
You can find this miRNA in MGI: Mir1897 (accession: 3811407)

References
[1]He S, Su H, Liu C, Skogerbo G, He H, He D, Zhu X, Liu T, Zhao Y, Chen R, BMC Genomics. 9:236(2008)., "MicroRNA-encoding long non-coding RNAs"