| Basic information from miRBase |
| hairpin accession number: MI0012687 |
| Located between position 83387805 and 83387877 on chromosome 4 strand + |
| mature miRNAs for MI0012687: |
| eca-miR-129a-5p (MIMAT0012932): CTTTTTGCGGTCTGGGCTTGC |
| eca-miR-129a-3p (MIMAT0012933): AAGCCCTTACCCCAAAAAGTAT |
| You can find this miRNA in ENTREZGENE: MIR129A (accession: 100314966) |
| References |
| [1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" |