| Basic information from miRBase |
| hairpin accession number: MI0008494 |
| Located between position 44041312 and 44041400 on chromosome 11 strand + |
| mature miRNAs for MI0008494: |
| ptr-miR-129 (MIMAT0008010): CTTTTTGCGGTCTGGGCTTGC |
| You can find this miRNA in ENTREZGENE: MIR129-2 (accession: 100316083) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |