Basic information from miRBase |
hairpin accession number: MI0011293 |
Located between position 5343246 and 5343321 on chromosome 3R strand + |
Overlapping with sense strand of CG8176-RA (intron 1). |
(Ensemble: FBtr0082065) (FlyBase: FlyBase) |
mature miRNAs for MI0011293: |
dme-miR-2283-5p (MIMAT0011791): GAAAATATCATGAATACGACAAT |
dme-miR-2283-3p (MIMAT0020909): TAGTATACGTGATATTTTAGG |
References |
[1]Lau NC, Robine N, Martin R, Chung WJ, Niki Y, Berezikov E, Lai EC, Genome Res. 19:1776-1785(2009)., "Abundant primary piRNAs, endo-siRNAs, and microRNAs in a Drosophila ovary cell line" |