miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0001638
Located between position 143592753 and 143592864 on chromosome X strand +
Overlapping with sense strand of Htr2c-006 (intron 4).
(Ensemble: OTTMUST00000045552)
mature miRNAs for MI0001638:
         mmu-miR-448-5p (MIMAT0017176): GAACATCCTGCATAGTGCTGCC
         mmu-miR-448-3p (MIMAT0001533): TTGCATATGTAGGATGTCCCAT
You can find this miRNA in MGI: Mir448 (accession: 3619406)

References
[1]Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M, Nature. 434:338-345(2005)., "Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals"
[2]Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A, Mol Hum Reprod. 16:463-471(2010)., "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
[3]Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP, Genes Dev. 24:992-1009(2010)., "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"