Basic information from miRBase |
hairpin accession number: MI0008813 |
Located between position 13326970 and 13327058 on chromosome 12 strand + |
mature miRNAs for MI0008813: |
ptr-miR-614 (MIMAT0008276): GAACGCCTGTTCTTGCCAGGTGG |
You can find this miRNA in ENTREZGENE: MIR614 (accession: 100316245) |
References |
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" ![]() |